View Full Version : ARCHIVE - The Science Behind Intelligent Design Theory-by Casey Luskin
Prisca
April 3rd, 2002, 08:52 PM
(http://www.ideacenter.org)
Intelligent design is a scientific theory which has its roots in information theory and observations about intelligent action. Intelligent design theory makes inferences based upon observations about the types of complexity that can be produced by the action of intelligent agents vs. the types of information that can be produced through purely natural processes to infer that life was designed by an intelligence. It makes no statements about the identity of the intelligent designer, but merely says that intelligent action was involved at some points with the origins of various aspects of biological life.
Intelligent design begins with observations about the types of information that we can observe produced by intelligent agents in the real world. Even the atheist zoologist Richard Dawkins says that intuitively, "[b]iology is the study of complicated things that give the appearance of having been designed for a purpose."1 Dawkins would say that natural selection is what actually did the "designing," however intelligent design theorist Stephen C. Meyer rightly notes that, "[i]ndeed, in all cases where we know the causal origin of 'high information content,' experience has shown that intelligent design played a causal role."3 Thus, like any true scientific theory, intelligent design theory begins with empirical observations from the natural world.
Critics of intelligent design have argued that although we may observe through experience that various structures are always made by intelligence, we can still argue that they were constructed by natural processes. A typical example given is the "arch" where in our experience humans make arches, but arches, such as the one found in Arches National Park (http://www.us-national-parks.net/images/arch3.gif), can be explained naturally. The problem here is that we have experience that some arches can be made by humans, and experience that some arches can be made through natural processes--exactly as witnessed by this one made in Arches National Park. A quick experiment with sand and water at the beach can vaguely reproduce what happened at Arches National Park, empirically verifying that natural processes can create arches. But this is no surprise. Natural arches themselves contain small amounts of information. In our experience we have no instances of specified complex information created through natural processes alone. Thus, as seen in Figure 1, intelligent design theory makes a testable prediction from observations from the natural world: that specified complex information will be found.
http://www.ideacenter.org/idempirical_big.gif
Figure 1. Diagram showing different processes which can produce entities: natural processes (chance-law based processes), intelligent design, or unknown natural laws. Only within intelligent design theory is specified complexity, and a special case of specified complexity--irreducible complexity (http://www.ideacenter.org/irredcomplex.htm)--found. Thus, at this point, intelligent design theory exclusively predicts that specified complex information will be found.
As seen in Figure 2, intelligent action can potentially produce just about any level of information content. However, as Dembski argues in his "No Free Lunch" and "The Design Inference", there is an upper limit to the sorts of information content which can be produced by natural processes (represented by Curve C). Where we see high [Dembski would add "specified"] information content, we know that natural processes were not involved, and that intelligent design alone can be responsible. Thus, we can infer design. When low information content is involved, it could have been designed, but the from our understanding of what natural processes can do, probability shifts towards the information having been produced by natural processes.
http://www.ideacenter.org/designspectrum.gif
Figure 2. Point A represents something probably made by natural processes. Point B represents something made by intelligent design. Curve C represents the upper limit to what natural processes can produce. Inferences made from both points A and B are based upon probabilities.
As Dembski says describing the processes by which we explain things, "the [explanatory] filter asks three questions in the following order: (1) Does a law explain it? (2) Does chance explain it? (3) Does design explain it?"5. If law or chance can explain low complexity, then perhaps we might accept a chance-law based explanation might be most appropriate for the origins of low information content. However, if only design can explain high information content, then we are justified in inferring design (Figure 3).
http://www.ideacenter.org/designevolutionspectrum.jpg
Figure 3. Design detection might be rudimentarily seen as a spectrum, as a function of information content. Structures with low information content are best described as having been produced by evolution, while those with high information content are best explained through design.
Information is a very real entity which may or may not be created by a conscious intelligent being. Design theorist William Dembski says,
"No one disputes that there is such a thing as information. As Keith Devlin (1991, p. 1) remarks, "Our very lives depend upon it, upon its gathering, storage, manipulation, transmission, security, and so on. Huge amounts of money change hands in exchange for information. People talk about it all the time. Lives are lost in its pursuit. Vast commercial empires are created in order to manufacture equipment to handle it."2
Dembski borrows accepted definitions from information theory to define information as the actualization of a possible event / scenario while excluding other events / scenarios. In other words, information is the narrowing down of what you're talking about. He quotes from Fred Dretske saying:
"Information theory identifies the amount of information associated with, or generated by, the occurrence of an event (or the realization of a state of affairs) with the reduction in uncertainty, the elimination of possibilities, represented by that event or state of affairs."2
Another definition Dembski gives is from Robert Stalnaker:
"Content requires contingency. To learn something, to acquire information, is to rule out possibilities. To understand the information conveyed in a communication is to know what possibilities would be excluded by its truth"2
Complexities of information are given by assigning probabilities to the excluded scenarios. When our observed scenario has a low probability and excluded scenarios have a high probability, we have information of high complexity. Through a mathematical transformation involving logarithms, probabilities of scenarios can be converted into units of information, measured in bits. DNA as a genetic molecule contains information because it tells you what to produce--to produce one entity rather than to produce other entities. This means it has information. (Now perhaps a DNA molecule on its own without the machinery to produce the proteins wouldn't have nearly as much information. So when I speak of DNA, in this context I mean the entire machinery for using the genetic code to create biological structures.)
Functions are biological features which do things for the organism. The purpose of intelligent design theory is to look at various functions and ask if they bear the marks of something which has been designed by an intelligence.
So, in other words, when we see in the biological structure-producing DNA machinery the ability to create some structures, and not others, which perform some specific action and not some other specific action, we can legitimately say that we have complex genetic information. When we specify this information as necessary for some function given a pre-existing pattern, then we can say it was designed. This is called "complex specified information" or "CSI".
However, because the intelligent design took place in the past, intelligent design theorists can only detect the design in the biological realm after it has happened. They cannot know the specification, or desired target before the design occurs. However, Dembski does note that, "a pattern corresponding to a possibility, though formulated after the possibility has been actualized, can constitute a specification."2 In other words, by observing things in the present, we can deduce the specified target of the designer in the past.
Dembski gives an analogy of six children who give their parents individual anniversary gifts, which, when put together, make a complete set of chinaware. We didn't know this complete set was possible or expected before the gifts were given, but we can still deduce and detect a pattern. But what sort of a pattern is there to which we can retroactively see that life corresponds?
Dembski argues that functionality is the pre-existing pattern to which life must always correspond. Dembski discussing functionality by saying the following:
"Arno Wouters (1995) cashes it out globally in terms of viability of whole organisms. Michael Behe (1996) cashes it out in terms of the irreducible complexity and minimal function of biochemical systems. Even the staunch Darwinist Richard Dawkins will admit that life is specified functionally, cashing out the functionality of organisms in terms of reproduction of genes. Thus Dawkins (1987, p. 9) will write: 'Complicated things have some quality, specifiable in advance, that is highly unlikely to have been acquired by random chance alone. In the case of living things, the quality that is specified in advance is . . . the ability to propagate genes in reproduction.'"2
If a function vital to survival of an organism of a given structure (the pre-existing specified pattern) could occur only if a given set of parts (the complex information) were present, and this complex set of parts were to come into being, then we could justifiably infer it was designed. Because we can observe intelligence being able to manipulate parts in an innovative manner to create novel CSI, the presence of CSI indicates design at some level, and removes the possibility that a chance-law mechanism such as the mutation-selection mechanism was responsible for it. Novel CSI itself cannot be generated by a chance-law based process, but rather can only be shuffled around4. As Stephen Meyer says, "Because we know intelligent agents can (and do) produce complex and functionally specified sequences of symbols and arrangements of matter (i.e., information content), intelligent agency qualifies as a sufficient causal explanation for the origin of this effect."3
Where the pattern is easily distinguished retroactively is when we know that a specific part is necessary for functionality. A useful way to do this is to consider the alleged evolutionary origin of a given function, and consider the specifications involved along the way:
For example, let us say that a primitive organism uses a hemoglobin-like molecule to dispose of unwanted oxygen. We observe that there are other organisms which use oxygen for respiration. We understand that their usage of oxygen involves a base number of different interacting enzymes and organ parts, not present in the organism which doesn't use oxygen. Thus, for an organism to use oxygen for respiration, we can see some pre-specified level of a target complexity necessary over the complexity found in organisms which don't use oxygen for respiration. Through "reverse engineering" of biological systems, we can come up with a target complexity retroactively. Irreducibly complex systems are useful in detecting design because they clearly show that some target level of specified complexity was necessary for some base level of functionality to be present. Looking at the steps necessary in the hypothetical construction of irreducibly complex systems may reveal many places where specifications must have existed in the past, and thus complex specified information exists in the present.
In all of this, there have been no mentions of God, religion, or adherence to any religious text but rather we use observations about how intelligent design works in the present to look at aspects of the natural world to see if they are designed. Intelligent design theory is based solely upon applying observations about intelligent action and principles of information theory to the construction of biological systems, and nothing more. There is nothing mystical, supernatural, religious, or non-scientific about intelligent design theory. In its current form, intelligent design theory also can say nothing about the designer other than that the designer was intelligent. Whether you agree with the methodology of intelligent design theory or not, you have to agree with one thing: it has a scientific basis.
References Cited:
1. Dawkins, Richard [zoologist and Professor for the Public Understanding of Science, Oxford University], "The Blind Watchmaker," [1986], Penguin: London, 1991, reprint, p.1
2. Intelligent Design as a Theory of Information by William Dembski as found at http://www.arn.org/docs/dembski/wd_idtheory.htm.
3. DNA and Other Designs by Stephen C. Meyer as found at http://www.arn.org/docs/meyer/sm_dnaotherdesigns.htm.
4. No Free Lunch by William Dembski (2001).
5. The Explanatory Filter: A three-part filter for understanding how to separate and identify cause from intelligent design by William Dembski.
_____________________________________
The above article has been reprinted with permission from the author.
http://www-acs.ucsd.edu/~idea/
http://www.ideacenter.org/chapters.htm
http://www.ideacenter.org/resourcesmenu.htm
http://www.ideacenter.org/fossrec.htm
http://www.ideacenter.org/origlife.htm
Lion
April 4th, 2002, 05:40 PM
Very interresting stuff. I really liked the Michael Behe mouse trap analogy.
Knight
April 4th, 2002, 06:01 PM
Great post thanks!
JGaltJr.
April 4th, 2002, 06:41 PM
Becky,
In what way is ID a scientific theory?
Lion,
It's understandable that to a lay person the analogy would seem to make sense but what Behe leaves out is that although a mouse trap can not work as a mouse a trap with even one missing part, it can work as something else, a paper weight for instance. This is true of so called irreducbly complex organisms as well.
Prisca
April 4th, 2002, 11:13 PM
JGaltJr., you said, “In what way is ID a scientific theory?”
First of all, let me say that I ‘m not a scientist and I ‘m certainly not an expert on ID theory. I do find it intriguing and that is why I asked Casey Luskin for permission to reprint the above article. I invited Casey to participate in any discussion the article might generate, but he/she had to decline due to other obligations (I apologize for not knowing whether Casey Luskin is a male or female).
So, is the ID theory scientific? In other words, does it follow the scientific method?
Scientific Method
1.Observe some aspect of the universe.
2.Invent a tentative description, called a hypothesis, that is consistent with what you have observed.
3.Use the hypothesis, to make predictions.
4.Test those predictions by experiments or further observations.
5.Modify the theory in the light of your results.
Let’s see if we can apply these steps to ID based on information from the above article:
1. Observe some aspect of the universe..
Observations are made about the types of information that we can observe produced by intelligent agents in the real world.
2. Invent a tentative description, called a hypothesis, that is consistent with what you have observed.
Make inference based upon observations about the types of complexity that can be produced by the action of intelligent agents vs. the types of information that can be produced through purely natural processes.
3. Use the hypothesis, to make predictions.
Complexities of information are given by assigning probabilities to the excluded scenarios. When an observed scenario has a low probability and excluded scenarios have a high probability, we have information of high complexity. Through a mathematical transformation involving logarithms, probabilities of scenarios can be converted into units of information, measured in bits.
4. Test those predictions by experiments or further observations. .
Where we see high information content, we know that natural processes were not involved, and that intelligent design alone can be responsible. Thus, we can infer design. When low information content is involved, it could have been designed, but from our understanding of what natural processes can do, probability shifts towards the information having been produced by natural processes.
5.. Modify the theory in the light of your results.
If law or chance can explain low complexity, then perhaps we might accept a chance-law based explanation might be most appropriate for the origins of low information content. However, if only design can explain high information content, then we are justified in inferring design.
JGaltJr.
April 5th, 2002, 12:12 AM
Thank you for you attempt Becky. Number four creates a problem for the ID camp though, in that we are not able to test the prediction because no one can create a universe. Your statement that "Where we see high information content, we know that natural processes were not involved, and that intelligent design alone can be responsible. Thus, we can infer design, " is simply false. We can not draw any such conclusion lest we engage in question begging. So I think you've demonstrated quite clearly that this in fact is not a theory in the scientific sense.
Daniel Arnold
April 5th, 2002, 12:20 AM
interesting
Prisca
April 5th, 2002, 02:45 AM
JGaltJr., you said, “Thank you for you attempt Becky. Number four creates a problem for the ID camp though, in that we are not able to test the prediction because no one can create a universe.”
We can test things in our environment, things that we already know were created by natural process or by intelligent design, to see if they conform to the theory using the mechanisms described in number 3. I did not say anything about the universe itself.
However, if number four creates a problem for the ID camp in regard to the creation of the universe, then it creates the same problem for the macro-evolutionist camp. We can at least test the ID theory on existing objects in our environment. Number four states:
4. Test those predictions by experiments or further observations.
When has macroevolution ever been witnessed through experimentation or observation? Yet it has still been elevated to the rank of accepted theory in the mind of the average person. The following quote is a fairly accurate description, I think, of the true state of the macroevolution “theory”:
The inability of science to test macroevolution, places evolution in a precarious position. All that can be said with any degree of certainty is that Darwin's last tenet probably should read something like this: ... through numerous, successive, slight modifications, driven by natural selection, the descendants of animals continually adapt. Through these adaptions life is optimized. These adaptions maximize variation and can bring about significant change. Nevertheless, since scientific experiments cannot test macroevolution, there is no direct evidence to suggest that the processes behind microevolution are responsible for macroevolution. In fact, since observable processes only create diversity, they should not be extended to explain the origin of complexity. (http://www.theory-of-evolution.org/Main/chap1/sec1/Darwin_extrapolation_2.htm)
http://www.theory-of-evolution.org/default.htm
JGaltJr.
April 5th, 2002, 08:39 AM
I notice you're doing what a lot of creationists do which is to switch the argument from a support of their own hypothesis to an attack on something they don't understand. Instead of going off on a tangent, let's stick to this topic. ID states that the god of the Bible created the universe. There are no IDers who believe in any other God. So I ask again, how is this a scientific theory. What observabe data is there to show such a thing?
Incidentally, ID is not in competition with evolution. ID is an hypothesis about the origins of life. Evolution explains origins of species, once life has already began.
Stratnerd
April 5th, 2002, 09:54 AM
Not sure if I can add anything to this but here's my two bits...
Scientific theories are inductive formulations to explain general natural phenomena. They cannot exist unless they have evidence and they get replaced when something with better explanatory power comes along.
I'm not sure if ID falls under the category of "natural" however the biggest problem I have with ID is that there's no known threshold for a probability to be considered "un-natural". When dealing with the origin of organisms this is especially problematic because of the confounding factor of historical contingencies (and all organisms have a history whether it be thousands or billions of years).
The skinny is... we can make all the predictions we want but we have no way of testing those predictions since we don't have a set of standards.
Prisca
April 5th, 2002, 02:04 PM
You said, “I notice you're doing what a lot of creationists do which is to switch the argument from a support of their own hypothesis to an attack on something they don't understand.”
No, I was trying to make a comparison between the promotion of one hypothesis (macroevolution) to the status of accepted theory and the rejection of ID as a theory even though it can be tested to a certain degree.
Because it is a theory, ID can only make predictions about certain aspects of our universe, but it makes those predictions based on data that can be successfully tested through step number 3 of the scientific method. This is not proof that life or the universe itself was created through intelligent design.
You said, “ID states that the god of the Bible created the universe. There are no IDers who believe in any other God.”As far as I can tell, ID says nothing about the source of the intelligence. Just because there happen to be Christians who are investigating the ID theory does not mean that it is exclusive to Christianity.
You said, “Incidentally, ID is not in competition with evolution. ID is an hypothesis about the origins of life. Evolution explains origins of species, once life has already began.
Again, I was making a comparison between a “theory” and “hypothesis” not a comparison between the ideas themselves.
JGaltJr.
April 5th, 2002, 02:24 PM
I think perhaps you don't understand the difference between a hypothesis and a theory. A hypothesis is an idea. A theory, in the scientific sense, has been tested and found to be accurate. When has this been done for ID?
And IDers are all Christians. It is 100% a Christian movement.
Prisca
April 5th, 2002, 02:56 PM
You said, “…the biggest problem I have with ID is that there's no known threshold for a probability to be considered "un-natural".”
This is a sensible statement and it deserves investigation. I am only remotely familiar with ID theory at this time and what you said deserves consideration.
It does seem to me, however, that most of us intuitively employ the use of ID theory in our everyday lives. For example, if I were to walk into my kitchen, I would intuitively know that the splash of spaghetti sauce on the floor happened “somewhat” naturally in that it took no intelligence to produce it. On the other hand, if I noticed that the spaghetti sauce had a tic-tac-toe pattern scratched through it, I would assume that some form of intelligence had been at work.
You said, “The skinny is... we can make all the predictions we want but we have no way of testing those predictions since we don't have a set of standards.
According to Michael Behe, “The conclusion of intelligent design flows naturally from the data itself—not from sacred books or sectarian beliefs. Inferring that biochemical systems were designed by an intelligent agent is a humdrum process that requires no new principles of logic or science. It comes simply from the hard work that biochemistry has done over the past forty years, combined with consideration of the way in which we reach conclusions of design every day.”
Darwin’s Black Box, The Biochemical Challenge to Evolution, (1996) Simon & Schuster, p. 193.
JGaltJr.
April 5th, 2002, 03:07 PM
"On the other hand, if I noticed that the spaghetti sauce had a tic-tac-toe pattern scratched through it, I would assume that some form of intelligence had been at work. "
I've never understood why creationists think this kind of analogy is accurate to biology. Has someone discovered a tic toe game carved inside a biological creature?
Evangelion
April 5th, 2002, 04:02 PM
Yes.
Namely, the West African Tic-Tac-Toe Frog.
Next question?
:)
Pilgrimagain
April 5th, 2002, 04:12 PM
ID and Scientific Deism are not exclusively Christian. If you are going to make that claim back it up.
As you can see from Behe's quote above, the idea flows fromt he data not the Bible.
Pilgrim.
PS. for the record I have read the book in toto and found it interesting but am not sure it's the end all be all. But Behe definately did his homework. He's a respected scientist with the proper credetials so I don't think one can just dismiss him.
JGaltJr.
April 5th, 2002, 04:19 PM
Can you name a single IDer who is not Christian? The idea comes from a desire to believe in a god and then assuming that certain organisms require one. It doesn't come from any legitimate data.
Phillip Johnson, a lawyer who is one of the main proponents of ID, recently acknowledged openly that he and most other IDers believed the god of the Bible is the ID author. The Bible of IDism, Behe's ...Black Box, was written by a devout Christian.
But back to the original point, what makes ID a true scientific theory?
Pilgrimagain
April 5th, 2002, 04:22 PM
well maybe most, but not all. The idea of scientific deism is nothing new.
JGaltJr.
April 5th, 2002, 04:26 PM
Deism and ID are two completely different camps. Deism began as a philosophical movement. It never pretended to be a scientific concept.
Pilgrimagain
April 5th, 2002, 04:53 PM
Oh, I must be mistaken, for some reason I thought there had been an initial link and simularity between the two...I apologise.
Peace,
Pilgrim
Evangelion
April 6th, 2002, 12:08 PM
What about the West African Tic-Tac-Toe Frog???
:confused:
Prisca
April 6th, 2002, 05:50 PM
You said, concerning my silly tic-tac-toe analogy, “I've never understood why creationists think this kind of analogy is accurate to biology. Has someone discovered a tic toe game carved inside a biological creature?”
Did I mention biology? No. I was making a silly analogy about the everyday use of ID theory. Can’t we have a light-hearted discussion once in a while?
We can get to biology, but what about the concept of ID theory itself? Remember, ID theory states:
Where we see high information content, we know that natural processes were not involved, and that intelligent design alone can be responsible. Thus, we can infer design. When low information content is involved, it could have been designed, but from our understanding of what natural processes can do, probability shifts towards the information having been produced by natural processes.
So, when the archeologist comes across these…
http://www.fastlane.net/~sterling/pointpics/2garys.JPG…he intuitively employs ID theory to surmise that the object is a product of intelligent design and not just an ordinary rock. Can you at least agree to that aspect of the theory?
Lion
April 6th, 2002, 06:11 PM
JGaltJr.-said: Lion,
It's understandable that to a lay person the analogy would seem to make sense but what Behe leaves out is that although a mouse trap can not work as a mouse a trap with even one missing part, it can work as something else, a paper weight for instance. This is true of so called irreducbly complex organisms as well.
Ummmm…true, but then it wouldn’t be a mousetrap, would it? So it would be useless for getting rid of the little pests from my garage…just as it would be useless for a paperweight, rather than flagellum, to attempt to propel bacteria.
Arminian
April 7th, 2002, 12:46 AM
But this is no surprise. Natural arches themselves contain small amounts of information. In our experience we have no instances of specified complex information created through natural processes alone.
I'm no novice when it comes to Information Processing theory. In fact, I contrubuted to much of the research on the Generation Effect in the 90's. But my background is in cognitive psychology(learning, memory and cognition).
I have no experience with this "ID" theory, however. Perhaps it came after the Roberta Klatsky years, when I was exposed to IP theory.
Nonetheless, there is some confusion caused by the polyvalent use of terms, and the unscientific application of terms (the lack of operational definitions and instrumentalism). I saw that someone has already mentioned how creation scientists skew theory and then apply it to their desired conclusions. (I'm not against CS, per se, but I do want to be honest.)
I want to say something about the following comment: "we have no instances of specified complex information created through natural processes alone." First of all, objects don't "create information." Objects are "understood" by beings that have the capacity to make associations concerning objects and events, maintain theories, and function as though those theories are true. Is there a "lot of information" in a rock? Sure there is, to a geologist, a physicist or a chemist, but not to me. If, however, I handed a CD of this week's top 40 hits to a caveman (I'm not being sexist. I haven't had much exposure to cavewomen, so I can't predict what they might do.:D ) , he'd say there isn't much info there, because he wouldn't know that it was more than a shiny disk. In other words, the objects themselves don't have the ability, capacity or the desire to teach us anything.
Here's a challenge to those of you who have access to a library. Go get Norwood Russell Hanson's Perception and Discovery. Start reading at chapter 4. It's an easy read, and I'm sure you'll learn a lot about yourself, as an observer. You'll thank me when you are done (or perhaps you'll curse me for bringing to your attention something that you can't stop thinking about!!).
Is there such a thing as a fact? Is a fact a "thing"? Why is it that we say "it is a fact that," such that "that-clauses" are always attached to the facts? The reason is that we are talking about observation, and observation is a theory-laden event. Without theories, people can't observe.
A rock collection has no voice. A waterfall has no voice. Is there a lot of information in a natural process, or the results of that process? It depends on who you are. Is there a lot of information in the output of the "show run" of a Cisco router? It depends on who you are.
I love those routers.
JGaltJr.
April 7th, 2002, 04:06 PM
Originally posted by Becky
Did I mention biology? No. I was making a silly analogy about the everyday use of ID theory. Can’t we have a light-hearted discussion once in a while?
Your analogy (which was a new take on the old 747 analogy which was a new take on the blind watchmaker analogy) was a compariosn to biological creatures. ID is based on explaining biology. IDers look at biology and say, "Hey this is too complicated for me to comprehend. God muist have done it." When you discuss ID you are discussing biology.
So, when the archeologist comes across these…
http://www.fastlane.net/~sterling/pointpics/2garys.JPG…he intuitively employs ID theory to surmise that the object is a product of intelligent design and not just an ordinary rock. Can you at least agree to that aspect of the theory?
From this alone, he could only surmise that perhaps it was made by a concsious mind. He could not infer that it absolutely was. He must further investigate to know for certain.
JGaltJr.
April 7th, 2002, 04:07 PM
Originally posted by Lion
JGaltJr.-said:
Ummmm…true, but then it wouldn’t be a mousetrap, would it? So it would be useless for getting rid of the little pests from my garage…just as it would be useless for a paperweight, rather than flagellum, to attempt to propel bacteria.
Yep it would be useless as a mousetrap. It would not be useless as something else.
Pilgrimagain
April 7th, 2002, 06:58 PM
they one thing I can not answer, and mind you, I am not a creationist or a b iblical literalist, but the one thing that stumps me is that there is no recorded instance of macro evolution in all of history. Certainly we should be able to observe that?
Peace,
Pilgrim
JGaltJr.
April 7th, 2002, 08:29 PM
There's actually quite a bit of evidence for it. Microevoultion leads to macro-evolution.
Here's a good begining on the subject. http://discusorigin.virtualave.net/Pro-Evolution/Macroevolution_frame.html
BTW, macro-evolution does not mean that a cat turns into a dog. A lot of creationists seem to think it does which is what causes the confusion about there being a lack of evidence.
ThinkerThinker
April 8th, 2002, 07:38 AM
Intelligent design theory makes inferences based upon observations about the types of complexity that can be produced by the action of intelligent agents vs. the types of information that can be produced through purely natural processes to infer that life was designed by an intelligence.
In our experience we have no instances of specified complex information created through natural processes alone.
The first problem with the argument is making the erroneous supposition; right at the start, that intelligence is not a natural process. That is typical of religious thinking that assumes man to be separate from the natural world so already you are not being scientific. You are saying there is no complex information except when produced by intelligence. That is somewhat like saying there will be no moon circling the earth except it there is gravity. The moon’s movement is a product of gravity just as complex information is a product of intelligence. The fact that only intelligence produces complex information means complex information is a unique product of intelligence not that intelligence is not natural, because otherwise we would have to call gravity unnatural because of the unique effects it creates. The second problem is the whole issue of complexity. There are two kinds of complexity in information content – data quantity and structure. The intelligent mind holds an enormous amount of data bits and its underlying structure is incredibly intricate. But what does this proof? Gravity produces galaxies, stars and planets with enormous amounts of “bits” and incredibly intricate structures. They are not the same “bits” and the same structures and information structures but these just points to their difference in nature not in the one being unnatural because it is different.
Your argument about “complex specified information” falls into the same category because I can apply those exact principles to gravity.
If a function vital to survival of an organism of a given structure (the pre-existing specified pattern) could occur only if a given set of parts (the complex information) were present, and this complex set of parts were to come into being, then we could justifiably infer it was designed. Because we can observe intelligence being able to manipulate parts in an innovative manner to create novel CSI, the presence of CSI indicates design at some level, and removes the possibility that a chance-law mechanism such as the mutation-selection mechanism was responsible for it.
I find this a baffling statement but it summarises the nature of your whole argument. Everything you state here follows the pattern of subdividing what should be continues and integrated into component parts and then using the differences, which appears because you do not accept the unity of the system and therefore do not see the connections, as proof that one thing, in this case intelligence, is not part of the whole and therefore not natural. Your inferences in the quote above, for instance, separates “the pre-existing specified pattern” and “complex information” which leads you to assume the vitality of intelligence rather that merely stating it as a benefit that developed along side the organism.
Nature is not a product of intelligence (it is the other way around) and does not fit into neat and orderly categories. Your statement that irreducibly complex systems are useful in detecting design because they clearly show that some target level of specified complexity was necessary for some base level of functionality to be present assumes that nature never allows systems to develop that are not strictly required or that systems does not develop that later assumes other functions when integrated with different sub-systems. Nature is a master at experimentation and utilising what is available. It also has enough resources and time to make an awful amount of mistakes, especially since it is not required to produce anything at all … but it does though simple statistical probability.
In all of this, there have been no mentions of God, religion, or adherence to any religious text but rather we use observations about how intelligent design works in the present to look at aspects of the natural world to see if they are designed.
What you fail to observe is this deep-seated, religious notion, that man is somehow separate from nature and this colours all your arguments. You do not need to mention God or religion to argue along religious criteria and believes. This last statement is simply an effort to give a veneer of being scientific and unbiased but this is clearly not the case.
TT
Lion
April 8th, 2002, 06:52 PM
You said, “What you fail to observe is this deep-seated, religious notion, that man is somehow separate from nature and this colours all your arguments.
In the above statement, you ignore your own bias. I could just as easily say to you:
What you fail to observe is this deep-seated, evolutionist notion, that man is merely a product of natural processes.
JGaltJr.
April 8th, 2002, 07:02 PM
Everything we see, has a natural process. It's logical to make the assumption that man is not separate from nature. It is illogical to assume that he is the result of something supernatural because we have no other precedent to suggest such a thing.
Arminian
April 8th, 2002, 09:39 PM
Pilgram:
but the one thing that stumps me is that there is no recorded instance of macro evolution in all of history.
What would a "recorded instance" look like?
ThinkerThinker
April 9th, 2002, 02:18 AM
Originally posted by Lion
In the above statement, you ignore your own bias. I could just as easily say to you:
What you fail to observe is this deep-seated, evolutionist notion, that man is merely a product of natural processes.
You are absolutely right but I don't try to hide the fact by pretending to be religious. My complaint was that Becky stated that the article was non-religious, based on observation, which was not true because of the assumptions made based on religious tendencies and this creates a false impression.
For many years I was deeply religious and devoted to serving God. Then I was bias and now I am bias on the other side, even though I make an effort to be non-bias. But what I don’t approve off is giving the impression of not being bias when this is not the case. We have to be brutally honest if we want to get to the truth.
TT
Lion
April 9th, 2002, 04:49 PM
ThinkerThinker-Well for most of my life I was an atheist and was biased. Now I am a Christian and I agree that I also am biased, however with that in mind it in no way invalidates an observation or a hypothesis. The way I look at them may be biased but the subjects themselves are not.
You said:What you fail to observe is this deep-seated, religious notion, that man is somehow separate from nature and this colours all your arguments. You do not need to mention God or religion to argue along religious criteria and believes. This last statement is simply an effort to give a veneer of being scientific and unbiased but this is clearly not the case.
In this statement you tried to say that because a person has Christian beliefs they cannot look at a thing in an unbiased way. That is either no more true, or just as true, (depending on your outlook) than it is for the evolutionist atheist. But neither of these things make the point.
The point is “does the hypothesis work in the real world?” Whether it is a Christian or atheist viewing it the data should be able to be seen for what it is
You dismiss the theory simply because it is used by Christians… Becky has shown that everyone uses this theory (perhaps it should be called a law) In everyday life all the time. As do all the sciences.
If you found your computer laying on the sidewalk you would never in a million billion trillion years believe that it grew there from natural processes. And that alone would show that you are using ID Theory in a real sense.
Lion
April 9th, 2002, 04:52 PM
JGalt- you said:Everything we see, has a natural process. It's logical to make the assumption that man is not separate from nature.
Really? We see life… what was the natural process that started that?
We see energy… what was the natural process that started that?
We see mater… what was the natural process that started that?
JGaltJr.
April 9th, 2002, 05:07 PM
Let's try this again, everything that we have an explanation for has a natural process. Everything. There is not a single instance of anything being shown to have a supernatural process. Not one. Now how is it more logical to assume something has a supernatural beginning than a natural beginning when everything else we've discovered the answer for has a natural explanation?
Just because an answer has not been discovered does not mean it must be attributed to the gods.
Why do religionists insist on taking the easy way out and saying, "I don't know the answer therefore God must have done it?" Especially considering that every other time in the past when the answer was discovered it turned out to be a natural process. Superstitious people believed lightning came from the gods. Turns out there's a natural explanation. Superstitious people believed disease came from sin. Turns out it had a natural explanation. Superstitious people today think origins have a supernatural explanation. Only time will tell but the evidence weighs pretty heavily against it. Why sacrifice your intellect for superstitious answers when science is far more fascinating than religious fairy tales?
Knight
April 9th, 2002, 06:27 PM
Now this is just plain silly!
Becky posts a picture of some arrowheads carved out of stone and she asks...
So, when the archeologist comes across these… (picture was here)
…he intuitively employs ID theory to surmise that the object is a product of intelligent design and not just an ordinary rock. Can you at least agree to that aspect of the theory?
And then JGalt says...
From this alone, he could only surmise that perhaps it was made by a concsious mind. He could not infer that it absolutely was. He must further investigate to know for certain.Are you serious??? Do you see what your worldview has done to you?? I would bet you were smarter when you were 5 years old than you are now. When you were five, you would have correctly been able to deduce without further investigation that the arrowheads were intelligently designed!
Furthermore, did you notice how JGalt refuses to call the arrowheads intelligently designed?
Instead he says "perhaps it was made by a concsious mind."! :down:
LOL! What like a dog maybe??? Or maybe a horse carved those arrowheads from stone eh JGalt??
JGalt's worldview has reduced him to a irrelevant pathetic dinosaur unable to offer intelligent rebuttals to simple questions that even a 5 year old could answer.
JGaltJr.
April 9th, 2002, 09:07 PM
Are you going to beg for my attention in every thread Knight?
Knight
April 9th, 2002, 09:53 PM
Originally posted by JGaltJr.
Are you going to beg for my attention in every thread Knight? Until you say something intelligent.... yes.
Seriously.... why not admit that the arrowheads were obviously created by Intelligent Design and admit that deduction does not take ANY further investigation?
How far would you take your logic? What if you found a hammer? How about a bicycle? Is there some sort of threshold in which you could determine intelligent design without "further investigation"?
JGaltJr.
April 9th, 2002, 10:07 PM
If someone with a little more decency than Knight cares to ask me those questions I'll be glad to answer.
Brother Vinny
April 9th, 2002, 10:21 PM
Ah, there's that call for "decency" again.
Here at TheologyOnline, we decide in our own minds what decency is.
That being the case, I'd say Knight is a pretty decent fellow. Who is JGaltJr to object?
Projill
April 9th, 2002, 10:45 PM
*has an overwhelming urge to mass mail TheologyOnline subscribers Richard Dawkins' book The Blind Watchmaker but then remembers that she's broke*
JGaltJr.
April 9th, 2002, 11:44 PM
Most wouldn't understand it anyway Projill, even if they did bother to read it.
notto
April 10th, 2002, 12:11 AM
Originally posted by Knight
How far would you take your logic? What if you found a hammer? How about a bicycle? Is there some sort of threshold in which you could determine intelligent design without "further investigation"?
What about a snowflake, a rock crystal, a perfectly smooth spherical rock?
Don't these things look designed as much as the arrowheads? Do you think that there are not "false" arrowheads found that are not manmade but appear to be? This is why we can't assume design without "further investigation".
What about a face on Mars?
It "looks" designed does not prove design. Saying something is too complex for nature to create is not a valid scientific argument because we have yet to investigate all of natures complexity!
JGaltJr.
April 10th, 2002, 12:25 AM
Notto I hope you realize you just committed the unpardonable TOL sin. You made a legitimate logical point. Expect to be demonized forever more by Knight and his band of not-so merry men.
Brother Vinny
April 10th, 2002, 07:29 AM
notto,
In the examples you gave-- a snowflake, a rock crystal, a spherical rock-- you only gave examples of symmetry appearing in nature, not design. Form without funtion, as it were.
As for the "face on Mars," it is interesting that you fall back on a thoroughly debunked hoax for support. Is this how all "scientists" work?
Now, I personally don't like arguing from design when talking to an atheist. Someone irrationally attatched to their atheism, as JGaltJr is, will not see a god behind the design of living species no matter how many examples are given. And arguing design with an atheist carries the false implication that the atheist can do such things as reason, make value judgments, etc., independent of the light of reason given by God.
Lion
April 10th, 2002, 07:40 AM
JGalt -you said:… everything that we have an explanation for has a natural process. Everything. There is not a single instance of anything being shown to have a supernatural process. Not one. Now how is it more logical to assume something has a supernatural beginning than a natural beginning when everything else we've discovered the answer for has a natural explanation?
It is more logical to assume that a supernatural process was used to create all the things I listed, IE-the creation of Life, Energy, and Matter, because otherwise they all defy the natural laws that we can explain.
How could a rock make itself? (defying the laws of thermodynamics)
How could Life come from non-life? (defying the law of a-biogenesis)
How could Energy create itself? (defying the laws of thermodynamics)
Those alone should be enough evidence to show that something outside of nature, (stronger than nature-therefore obeying the law of first causes), in other words supernatural, was at work in their creation.
Certainly better than… “well it’s just not explainable…” not a very compelling argument.
ThinkerThinker
April 10th, 2002, 07:53 AM
Originally posted by Lion
In this statement you tried to say that because a person has Christian beliefs they cannot look at a thing in an unbiased way.
No, I said Becky is misleading, not that Christians cannot look at a thing in an unbiased way.
You dismiss the theory simply because it is used by Christians…
No, I said the way Becky presented it is flawed.
If you found your computer laying on the sidewalk you would never in a million billion trillion years believe that it grew there from natural processes.
No, you’ve got it wrong. My point was that certain natural processes produce certain natural results. Gravity produce planetary motion, intelligence produces complex information systems. Becky tries to show that intelligence (God) created intelligence (human) that creates complex information systems. I say nature, produced intelligence (human) that creates complex information systems. Complex information systems are not unnatural because nothing else in nature, except intelligence, creates it unless you first assume intelligence is unnatural and THAT is the problem I have with the argument.
If you found your computer laying on the sidewalk you would never in a million billion trillion years believe that it grew there from natural processes.
Yes, I would believe it grew from a natural process. I grew from intelligence that is natural. Your argument is like a primitive man saying you would never in a million years believe something as massive as a moon can do circular movements from natural processes. Matter produces gravity hence circular movement. Matter produces intelligence hence the computer on the sidewalk.
Do you see your own preconceptions?
TT
notto
April 10th, 2002, 08:00 AM
Originally posted by Paul DeYonghe
notto,
In the examples you gave-- a snowflake, a rock crystal, a spherical rock-- you only gave examples of symmetry appearing in nature, not design. Form without funtion, as it were.
As for the "face on Mars," it is interesting that you fall back on a thoroughly debunked hoax for support. Is this how all "scientists" work?
Of course manmade objects (like the arrowhead) are designed. We know who designed them based on the context in which they were found. They only have function based on context. If I find a pointy rock that could be used as an arrowhead, should I assume it is designed because I can apply function to it? What about a pointy stick? My point is that if someone shows you a rock that looks like an arrowhead, you can't assume it was designed unless there is further evidence of its designer based on where it is found.
Each of the examples given in the thread I commented on for design are of non-animate objects, each of which has no capability to change or transform. This is not the case with biological entities, escpecially DNA. DNA has a viable mechanism to change from generation to generation, mainly mutation and natural selection. ID tries to put limits on this change show a mechanism that limits this change. It all falls back on the "it looks designed" or "it is too complex for nature".
The face on mars was an example of where if we use the "it looks designed" argument, we end up with a false conclusion. Of course this has been debunked, that was my point. It was debunked after further investigation and a natural explanation for the feature was provided. Scientists didn't think it was built by intelligence from the start, it was the UFOlogists and the non-scientists who insisted it was designed before all of the facts were in.
ThinkerThinker
April 10th, 2002, 08:14 AM
Originally posted by Lion
How could a rock make itself? (defying the laws of thermodynamics)
How could Life come from non-life? (defying the law of a-biogenesis)
How could Energy create itself? (defying the laws of thermodynamics)
“How could a rock make itself?”
How could God make itself?
No God was always there. Oh, so was the rock.
“How could Life come from non-life?”
How could the supernatural nature of God come from non-supernature?
No, God is a form of supernatural. Oh, well life is a form of natural.
“How could Energy create itself?”
How could God create itself?
No God was always there. Oh, so was the energy. (By the way, matter, and therefore the rock, is just another state of energy so this is the same as your first example).
So you see, you just push the argument on step back into a believe system where nothing can be proved. With the argument there you feel satisfied and do not have to confront some difficult questions. You resolve nothing except your own fears.
TT
Brother Vinny
April 10th, 2002, 09:22 AM
notto,
The ID argument goes well beyond cells and organs merely "looking" designed and into design functions, which is where irreducible complexity comes in. A snowflake, while being aesthetically complex, has no function to fulfill, and does not cease being a snowflake if a small piece is broken off.
As stated, I really don't like arguing ID. For starters, I don't see it as having any real bearing on the worldview of an atheist: The atheistic worldview has as its governing presupposition the non-existence of God (or any god), so any information he collects will be filtered through that presupposition.
Another reason is that evolutionists have already made inroads in challenging the ID argument. Dr. Kenneth Miller, who happens to be a theist, has made some plausible arguments in his book, Finding Darwin's God, as to how irreducibly complex organs and systems may have evolved, e.*., the now irreducibly complex human eardrum perhaps having once been a simpler organism's tympanic membrane and the bones just beneath it. The book didn't make me an evolutionist, but it did point out some weaknesses in my arguments, and I would encourage those involved in this debate to read it if only to strengthen their own positions.
JGaltJr.
April 10th, 2002, 11:08 AM
Originally posted by Lion
JGalt -you said:
It is more logical to assume that a supernatural process was used to create all the things I listed, IE-the creation of Life, Energy, and Matter, because otherwise they all defy the natural laws that we can explain.
How could a rock make itself? (defying the laws of thermodynamics)
How could Life come from non-life? (defying the law of a-biogenesis)
How could Energy create itself? (defying the laws of thermodynamics)
Those alone should be enough evidence to show that something outside of nature, (stronger than nature-therefore obeying the law of first causes), in other words supernatural, was at work in their creation.
Certainly better than… “well it’s just not explainable…” not a very compelling argument.
Who ever claimed that a rock made itself or that energy made itself? I ask again for you to explain how it is logical to look at a world for which every answer we've discovered so far as a natural explanation and assume that the few answers we don't have must be answered by copping out and sauying, "God did it. That's good enough for me." Please explain how that is logical. What evidence is there that any god created anything. Not having an answer is not evidence for a god.
Warren
April 10th, 2002, 12:21 PM
Intelligent design is not anti-evolution per se. ID is an alternative hypothesis to non-teleological evolution which is often referred to as the blind watchmaker. A good definition of non-teleological evolution was provided by the National Association of Biology Teachers a few years ago. In it's first draft it said:
"The diversity of life on earth is the outcome of evolution: an unsupervised, impersonal, unpredictable, and natural process of temporal descent with genetic modification that is affected by natural selection, chance, historical contingencies, and changing environments."
The NABT definition of evolution has successfully drawn the line between a non-teleological and a teleological interpretation of natural history. Note that evolution is defined as "unsupervised, impersonal ... natural process." There is obviously no role for any intelligence to even guide an evolutionary process.
This NABT position on evolution is identical to the blind watchmaker hypothesis promoted by Richard Dawkins:
"The complexity of living organisms is matched by the elegant efficiency of their apparent design. If anyone doesn't agree that this amount of complex design cries out for an explanation, I give up. No, on second thought I don't give up, because one of my aims in this book is to convey something of the sheer wonder of biological complexity to those whose eyes have not been opened to it. But having built up the mystery, my other aim is to remove it again by explaining the solution.....Natural selection, the blind, unconscious, automatic process which Darwin discovered, and which we know is the explanation for the existence and apparently purposeful form of all life....Natural selection has no mind and no mind's eye. It does not plan for the future. It has no vision, no foresight, no sight at all. If it can be said to play the role of watchmaker in nature, it is the blind watchmaker.""[Richard Dawkins, The Blind Watchmaker (1987), ix.]
Now, here's the point. There is currently no way to DIRECTLY detect the existence of either a teleological or NON-teleological cause from ancient history. ID and blind watchmaking are in the same boat in regard to direct verification. The ID critic's positon seems to be that there is positive evidence for blind watchmaking therefore in order for ID to compete with blind watchmaking it needs to present proof. But this isn't the case. The best either side can do when investigating ancient natural history is to infer a cause indirectly to determine how well those inferences make sense of the data we have.
ID and blind watchmaking are both based on inferences not proof. ID critics don't seem to understand that. That is why I often ask them what evidence would cause them to infer intelligent design. When you examine their responses it becomes obvious they will accept nothing less than absolute proof. But if we had proof of ID there would be no need to infer it! The ID critics are incapable of inferring design. On the other hand, they have no trouble inferring blind watchmaking from very meager evidence. Why the double standard?
So, the ID hypothesis shouldn't be evaluated in isolation, rather we should compare it with the blind watchmaker hypothesis. Darwin often argued to his correspondents, that his theory had to be weighed COMPARATIVELY, "vis-a-vis its competitors."
So let's compare the ID hypothesis with the blind watchmaker hypothesis. Please reference any peer reviewed article that demonstrates that a non-teleological cause was behind the origin of life, the origin of molecular machines, the origin of the genetic code or the origin of mammals.
Knight
April 10th, 2002, 12:25 PM
notto, all I am asking is.... if you found the arrowheads that becky pictured on page 2 of this thread could/would you deduce that the arrowheads were intelligently designed? Or would you need "further investigation" as JGalt would need?
notto
April 10th, 2002, 12:57 PM
Originally posted by Knight
notto, all I am asking is.... if you found the arrowheads that becky pictured on page 2 of this thread could/would you deduce that the arrowheads were intelligently designed? Or would you need "further investigation" as JGalt would need?
As I mentioned in my response, it would depend on the context of where they were found. If they are found with other fashioned tools in an area that we know was inhabited by stone tool makers, then sure, I would deduct that they are designed based on the fact that I can see evidence of the designer
If they were found in large quarry of hundreds of thousands of shattered rocks, with different shapes, by someone who was looking for and selecting rocks that look like arrowheads, then I would say that they are not designed.
The shape of the arrowheads in themselves does not tell us they are designed, mearly that they look like something that could be designed, or could happen by chance. We must put them into context to determine which it is and if we are to determine that they are designed, we must have evidence of the designer, and establish that known natural forces could not have created them where they were found.
If you found rocks in a quarry of smashed and jagged rocks that look like those arrowheads, would you assume that they are designed without doing further investigation?
Warren
April 10th, 2002, 02:13 PM
I keep hearing that ID is the hypothesis that the universe and living creatures are too complex to have arisen by chance alone and God must have been involved.
I think some persons on this forum lack appreciation for just how diverse the ID movement is. While it is true (for now) that a lot of IDers argue like this, many of us differ. For example, many ID'ers do not accept this argument at all. For them, ID is simply the inference to the best explanation and does not entail the designer be God. They tentatively infer ID behind the origin of life, as the evidence that currently exists favors ID. Also, given that there really is no evidence that chance and natural selection were indeed the mechanisms behind the origin of major evolutionary innovations, they remain open to ID beyond the realm of abiogenesis.
Knight
April 10th, 2002, 02:46 PM
No matter where I found those arrowheads (and I am talking specifically about the arrowheads pictured on page 2 of this thread) I would deduce WITHOUT any further investigation that they were indeed intelligently designed.
I am being honest when I say... I think it would be silly to think otherwise as you would be just wasting your time "investigating further".
Can I ask you something?
Look at the picture below...
http://www.fastlane.net/~sterling/pointpics/2garys.JPG
Can you tell me what is in the picture?
In your own words, what is in the picture?
Warren
April 10th, 2002, 06:27 PM
Forget about arrowheads. What if a 10 million year old mousetrap was discovered? Would anyone doubt it was the product of intelligent design even though we had no idea who the designer was? Would inferring it was intelligently designed be unscientific? Would anyone seriously propose that we postpone a conclusion of design until we had eliminated the possibility that some undiscovered non-intelligent process created the mousetrap?
Lion
April 10th, 2002, 08:04 PM
ThinkerThinker-First, you failed to answer any of the questions I posed. You instead asked questions of your own in an attempt to obfuscate.
In fact I already answer all of the questions you posed, in this statement; Those alone should be enough evidence to show that something outside of nature, (stronger than nature-therefore obeying the law of first causes), in other words supernatural, was at work in their creation.
God is the first cause. He has always been. He is greater than, and the creator of, the laws of nature and therefore not subject to them. Therefore my system of belief in no way negates science or its natural laws, but you can in no way say the same. Since your system of belief defies its own laws at every turn. IE;
A rock made itself. (defying the laws of thermodynamics)
Life came from non-life. (defying the law of a-biogenesis)
Energy created itself. (defying the laws of thermodynamics)
Lion
April 10th, 2002, 08:08 PM
JGalt-Oh, I’m sorry, perhaps I misunderstood your stand on things.
I thought you believed in natural processes. That would mean that you believe that either;
All matter and energy have been here forever,
or,
That a rock created itself.
Just so I’m clear please let me know how you think the first rock got here by natural explanations?
Lion
April 10th, 2002, 08:10 PM
Warren-I like it!
Lion
April 10th, 2002, 08:18 PM
Knight-I would say it came about by intelligent design…. But then I thought the Boeing 747 carving on the ancient pottery looked like a dinosaur. So what do I know.
Oh by the way I was watching Discovery the other day and they found an arrowhead in that five thousand year old “Ice Man” mummy, and now believe that he was murdered.
Funny thing was, as soon as they saw the arrowhead on the MRI they never questioned that it was anything but a man made, intelligently designed, arrowhead. Those silly scientist.
Hank
April 10th, 2002, 09:37 PM
Knight says:
No matter where I found those arrowheads (and I am talking specifically about the arrowheads pictured on page 2 of this thread) I would deduce WITHOUT any further investigation that they were indeed intelligently designed.
This is exactly why for thousands of years we "knew" the world was flat and that the sun rotated around the earth. We deduced without investigation.
JGaltJr.
April 10th, 2002, 10:48 PM
Originally posted by Lion
JGalt-Oh, I’m sorry, perhaps I misunderstood your stand on things.
I thought you believed in natural processes. That would mean that you believe that either;
All matter and energy have been here forever,
or,
That a rock created itself.
Just so I’m clear please let me know how you think the first rock got here by natural explanations?
Lion why do you think that rock would have to create itself? Do you think a rock is an irreducible entity? Rocks are made of different things and I don't know which one was the first one but which ever one it was, it was formed by the combining of various elements into a rock. If you're asking how the first elements came about. I don't know. No one knows. That's the point. Just because we don't know is no reason to cop out and infer that there is a god who created them. It really is okay just to say "We don't yet know how that happened." What we do know, is that for every process for which we've found an answer, not one of those answers has involved a supernatural cause. Now I ask yet again, why do you think it's logical to suggest a supernatural cause is needed for natural things when there is not a single instance of a supernatural cause ever being needed for anything?
JGaltJr.
April 10th, 2002, 10:51 PM
Originally posted by Warren
Forget about arrowheads. What if a 10 million year old mousetrap was discovered? Would anyone doubt it was the product of intelligent design even though we had no idea who the designer was? Would inferring it was intelligently designed be unscientific? Would anyone seriously propose that we postpone a conclusion of design until we had eliminated the possibility that some undiscovered non-intelligent process created the mousetrap?
Yes Warren, if a 10 million year old mouse trap was found it would certainly be logical to suggest a designer had created it, but we aren't talking about mouse traps. The analogy is not accurate. This topic came up in the begining of the thread.
JGaltJr.
April 10th, 2002, 10:54 PM
Originally posted by Lion
Funny thing was, as soon as they saw the arrowhead on the MRI they never questioned that it was anything but a man made, intelligently designed, arrowhead. Those silly scientist.
Have any idea why they thought that? If you can figure that out then you'll understand what both I and Thinker-Thinker have said about it.
ThinkerThinker
April 11th, 2002, 03:01 AM
Originally posted by Lion
Therefore my system of belief in no way negates science or its natural laws, but you can in no way say the same. Since your system of belief defies its own laws at every turn. IE;
A rock made itself. (defying the laws of thermodynamics)
Life came from non-life. (defying the law of a-biogenesis)
Energy created itself. (defying the laws of thermodynamics)
I assume you meant the second law of thermodynamics because the first does not apply and the third is not relevant so:
Entropy increase only in isolated systems. When there is an exchange of energy between systems it can is possible for complexity or order to develop (like your rock). A more obvious example of this principle is the everyday formation of clouds. It is a non-isolated system that produce an increase in complexity. The second law doesn't apply to non-isolated systems.
It has been verified that the universe has obeyed the second law of thermodynamics ever since the time of the big bang. And before the big bang? Well before the big bang there was no time just as there was no matter and without time there is no second law to violate.
Now, you might argue that it takes an awful lot of faith to say the universe came from nothing or has been there forever but at least I can point to the universe and say well it’s there. You cannot do the same. You cannot say God came from nothing or has been there forever, point him out to me and say well he’s there.
The law of biogenesis, for as much as it is a law, only states that life cannot arise from the nonliving under conditions that NOW exist upon our planet or as we currently are able to create in the lab. That is pretty obvious but when life developed from non-life the conditions are not what they are today and the fact that scientists have not been able to recreate the conditions does not proof they will not be able to do so in the future. Life is just another matter/energy construct and there is more than enough examples that demonstrate matter/energy has no problem developing from one construct to another.
TT
Warren
April 11th, 2002, 10:25 AM
Opponents of ID continue to equate ID theory with supernatural processes and this is just plain wrong. I think part of the problem is that some creationists are using intelligent design as part of their apologetic program for proving that the God of the Bible exists, nevertheless, ID as a theory presupposes neither a supernatural creator nor miracles. ID is a tool used in an investigation that endeavors to determine if some aspects of biotic reality are better explained by reference to a seeing watchmaker rather than a blind watchmaker. A seeing watchmaker need not be a supernatural agent and may be endowed with nothing more than human-like intelligence. Intelligent Design is theologically minimalist. It detects intelligence without speculating about the supernatural. Biochemist Michael Behe's "irreducible complexity," physicist David Bohm's "active information," mathematician Marcel Schutzenberger's "functional complexity," and William Dembski's "complex specified information" are alternate routes to the same reality.
It is the empirical detectability of intelligent causes that renders Intelligent Design a fully scientific theory, and distinguishes it from the design arguments of philosophers, or what has traditionally been called "natural theology."
ID looks for patterns of data from life that can best be interpreted as traces of bioengineering. It may not be perfect. It promises no certain knowledge. But it does employ reasonable constraints to generate focus and make testable hypotheses. And that is all that matters.
Finally, ID is premised not on a quest for certainty or an attempt to convert all scientists to its methodology. ID is for those whose thinking lies somewhere between those who think the case for design is obvious and true and those who think it is non-existent. ID is for those who don't buy into the notion that we need to show abiogenesis/evolution is impossible before introducing design (as the anti-design folks believe). ID is for those who recognize that if design occurred sometime in the distant past, there would likely be no independent evidence of the designer apart from the properties of the designed thing, which in themselves, are always open to re-interpretation without a designer. ID is for those who seriously *suspect* design for whatever reason.
For instance, I suspect design for many reasons none of which are based on Biblical text. Here are a few: the need to employ teleological concepts and language to understand biology (but not other areas of science); the encoded information in DNA being likened to a software code according to many scientists, the growing appreciation that the cell is far more like a factory of organized molecular machines than a soup; the growing intractability of abiogenesis in light of new knowledge; and the manner in which so much of early life looks front-loaded with information such that its evolution since looks mostly like the shuffling and tinkering of pre-existing endowments. For some people, such reasons may be sufficient to conclude design. For me, such reasons only impart a strong suspicion of design. ID enables one to build on this strong suspicion by looking for the specific traces of design and to use design to generate further coherency.
ID is thus not a generic method to distinguish design from non-design. It is a method that scores things to allow one to either strengthen or weaken their suspicions as regards to the thing in question.
Richard Dawkins begins his book The Blind Watchmaker with the observation that "biology is the study of complicated things that give the appearance of having been designed for a purpose." I agree, therefore I work with the assumption that if something looks designed, it probably is unless there is good reason to think otherwise and if something looks evolved, it probably is unless there is good reason to think otherwise. And the exciting by-product of this approach is the generation of testable hypotheses that have the ability to increase general knowledge about the world. Knowledge that we could never find using a methodology that rejects design. But in the anti-ID'ers perceptual field, things that look evolved and things that look designed are all the products of evolution. Of course they are going to complain about ID.
As I see it, something that exhibits machine-like complexity is likely to be the product of design unless there is good reason to think otherwise. This is because we know of thousands of machines whose origin is *known* to be from design.
Since opening the black box of the cell, many things have turned out to look strangely machine-like. So machine-like, I view them as literal machines and there is no good argument against this perception. This, of course, is to be expected from a design event and design proponents have a long history of likening living things to machines. This was also NOT expected from the viewpoint that excluded design, as has been documented with the observations of leading scientific figures. More importantly, however, is that this ID/machine paradigm is a fruitful guide to research.
Now the common objection to this is that human artifacts are not biological or biochemical systems. But those that make this objection must be unaware of all the biotechnology that has arisen on this planet in the last few decades.
I think the biological machines that make up the core of life are sufficiently analogous to man-made machines to make an ID inference. We know they are at least analogous enough that the president of the National Academy of Sciences (Bruce Alberts) has proposed that biologists begin to learn from engineers to understand biology. I therefore, see no problem with treating life as carbon-based nanotechnology.
Knight
April 11th, 2002, 10:39 AM
Originally posted by Hank
Knight says:
This is exactly why for thousands of years we "knew" the world was flat and that the sun rotated around the earth. We deduced without investigation. Uhhhh.... Hank turn on the noggin.
Knight
April 11th, 2002, 10:43 AM
Come on guys......
notto, JGalt, TinkerThinker, even Hank.....
What are the two objects in this picture?
http://www.fastlane.net/~sterling/pointpics/2garys.JPG
notto
April 11th, 2002, 11:46 AM
Originally posted by Knight
Come on guys......
notto, JGalt, TinkerThinker, even Hank.....
What are the two objects in this picture?
http://www.fastlane.net/~sterling/pointpics/2garys.JPG
I believe I have already answered what's in the picture. Rocks that look like manmade arrowheads. I can say that they are probably manmade because I can compare them to other existing manmade arrowheads that have been shown to be manmade. I use existing knowledge of what an arrowhead looks like, my knowledge of the fact that indeed men make arrowheads, and the fact that it would be very rare for a rock that looks like an arrowhead to form naturally.
In order to PROVE that they are indeed manmade arrowheads, I would need to look further into the context of where they were found, to make sure that there is evidence that they were manufactured and that a designer existed to manufacture them (and that they could not have been formed by a rare, natural event). I can't base a proof on past arrowhead finds, I can only make a reasonable assumption based on those past finds. This is the point of addressing this analogy in the way I have done when it is used as an analogy for ID. I personally determine they are most likely manmade arrowheads by comparing them to other manmade arrowheads. You can't use this analogy to explain things that we have not every observed being designed!
Arrowheads don't have a way to change and build themselves, and pass improved traits (more arrowlike) unto new arrowheads, unlike living organisms. This is why this analogy fails as an argument for ID in naturally formed entities and why it is easier for us to determine that inanimate and unchanging objects that are complex are indeed the product of manmade manufacturing (ID). Natural processes are creative and dynamic and provide pathways to change (and select for change) to animate entities. We can't say that these entities are designed based on our past knowledge because we have never seen them designed (unlike the arrowheads) and we cannot show how they could be designed (again, unlike the arrowheads). There is also no evidence of a creator or evidence of the actions of a creator in the animate objects, unlike the arrowheads scratchs, chips, and marks that show me that the rock was acted on my an outside creator.
Since there is no evidence of a creator in animate objects, why should we assume one exists (when there is no need to to explain what we know so far and can see)? Until all of the natural, dynamic, creative processes are know and can be identified, there is no need to introduce a creator into our analysis of living beings. To do so is just to introduce a "Designer of the Gaps".
Knight
April 11th, 2002, 11:54 AM
OK folks notto cannot identify the objects in the picture, he can only say they are "Rocks that look like manmade arrowheads." anyone else want to take a stab (no pun intended) at it?
ThinkerThinker
April 11th, 2002, 02:58 PM
Originally posted by Knight
Come on guys......
notto, JGalt, TinkerThinker, even Hank.....
What are the two objects in this picture?
OK, I agree with notto and think his answer is adaquet but I will add this picture:
http://www.taucon.com/stoneAxe1.jpg
I went to look for something like this to make a point. Excuse my lack of digital photography skills. This is a river stone and not a stone made by cavemen but I think it is a better "design" then your example. I added some circles where I think your fingers can go to use it as a dagger.
As I said, notto got it about right in his post but I think you do not grasp what he is really saying.
TT
Knight
April 11th, 2002, 03:33 PM
Thinker.... why not try thinking?
I asked you specifically about the picture I posted! Your rock would indeed take "further investigation".
So you are joining notto in admitting you could NOT identify (without further investigation) what the items are in the picture? How sad!
Anyone else?
What are the two objects in this picture?
http://www.fastlane.net/~sterling/pointpics/2garys.JPG
notto
April 11th, 2002, 04:09 PM
Originally posted by Knight
Thinker.... why not try thinking?
I asked you specifically about the picture I posted! Your rock would indeed take "further investigation".
So you are joining notto in admitting you could NOT identify (without further investigation) what the items are in the picture? How sad!
Anyone else?
What are the two objects in this picture?
http://www.fastlane.net/~sterling/pointpics/2garys.JPG
The question you should be asking yourself is not what's in the picture but
1) How do we know that these are manmade arrowheads (comparison with other, tested arrowheads and past knowledge of arrowheads).
2) How would you PROVE these are manmade arrowheads (By further analysis not based on any previously found arrowheads).
3) Why did I hijack this thread to discuss arrowheads when the topic was Intelligent Design as a scientific theory.
JGaltJr.
April 11th, 2002, 04:27 PM
They certainly look like arrowheads Knight.
Prisca
April 11th, 2002, 04:58 PM
Thank you for posting that picture. You saved me some time. The reason I specifically chose arrowheads in the first place, was because I recently watched a program which suggested that many “supposed” arrowheads, may in fact have been created by natural processes. While I agree this could and does happen, there is a point at which intelligent design becomes obvious. Arrowheads are a great example because we can begin to demonstrate a “dividing line” between chance and intent. But what is that “dividing line?”
Complexities of information are given by assigning probabilities to the excluded scenarios. When our observed scenario has a low probability and excluded scenarios have a high probability, we have information of high complexity. Through a mathematical transformation involving logarithms, probabilities of scenarios can be converted into units of information, measured in bits.
Even without converting the information our arrowheads contain into bits of measured information, we can infer that my arrowheads are more likely the products of intelligent design than yours. Does that exclude yours? No:
“intelligent action can potentially produce just about any level of information content”
But, “there is an upper limit to the sorts of information content which can be produced by natural processes.” So, what is that “upper limit”? Can we detect it? Is it present in biological and biochemical systems? If it is, why is it important?
As Warren stated, “… the exciting by-product of this approach is the generation of testable hypotheses that have the ability to increase general knowledge about the world. Knowledge that we could never find using a methodology that rejects design.”
Knight
April 11th, 2002, 05:54 PM
OK, no more about arrowheads and those who can't recognize them.
ThinkerThinker
April 12th, 2002, 02:37 AM
I am glad the arrow head debate has now been settled but just a point to Knight:
noot wrote: I can say that they are probably manmade because I can compare them to other existing manmade arrowheads that have been shown to be manmade.
A lot of the problems we have, which leads to misunderstanding and conflict, are actually caused by drawing conclusions from available information then presenting them as fact. Notto's approach is more cautious in that it leaves room for being wrong. This is in fact a much more sensible approach because it allows you to remain open to other suggestions and not become fanatical and close minded to alternative ideas. Notto admits those looks like arrowheads but that it might be a mistaken assumption. That's called maturity and such maturity often results in better understanding.
TT
Warren
April 12th, 2002, 08:52 AM
The Blind Watchmaker hypothesis says that natural selection, in combination with random mutation, has the kind of creative power needed to make complex plants and animals out of very much simpler predecessors. If Darwinian selection does not have the required creative power, then "evolution" in some general sense may still be true, but science does not know how creative evolution has occurred. The materialist belief that a blind watchmaker turned microbes into magpies, maple trees and musicians doesn't require any evidence because a blind watchmaker is a logical deduction from materialism. If a critic finds the current blind watchmaker inadequate to explain everything that's occurred in natural history, his only permissible move within science is to suggest a better blind watchmaker. That a competent blind watchmaker may not exist at all and that certain aspects of biotic reality may be better explained by a seeing watchmaker is not a logical possibility. Thus, most scientists don't investigate to determine IF life evolved, they only search for ways life DID evolve. Now, why should it be surprising to materialists that non-materialists remain skeptical of the current blind watchmaker hypothesis and feel that evidence for a seeing watchmaker may not be getting a fair hearing?
Richard Dawkins doesn't say that biology is the study of complicated things that give the appearance of having evolved. Instead he says, "biology is the study of complicated things that give the appearance of having been designed for a purpose." If nature looks this way to a materialist like Dawkins then what's wrong with a non-materialist having a suspicion that biological things that exhibit machine-like complexity look designed because they are designed? In particular those things for which there is no evidence they evolved solely through non-intelligent processes.
Here is an interesting quote that describes the machine-like nature of the cell:
"We have always underestimated cells. Undoubtedly we still do today. But at least we are no longer as na‹ve as we were when I was a graduate student in the 1960s. Then, most of us viewed cells as containing a giant set of second order reactions: molecules A and B were thought to diffuse freely, randomly colliding with each other to produce molecule AB - and likewise for many other molecules that interact with each other inside a cell. But, as it turn out, we can walk and we can talk because the chemistry that makes life possible is much more elaborate and sophisticated than anything we students had ever considered. Indeed, the entire cell can be viewed as a factory that contains an elaborate network of interlocking assembly lines, each of which is composed of a set of large protein machines." [Alberts, B. 1998. The Cell as a Collection of Protein Machines: Preparing the Next Generation of Molecular Biologists. Cell 92; 291-294.]
Physicist and science writer Paul Davies also has come to understand the essence of life at its molecular level. In his book The Fifth Miracle he says:
"Each cell is packed with tiny structures that might have come from an engineer's manual. Miniscule tweezers, scissors, pumps, motors, levers, valves, pipes, chains, and even vehicles abound. But of course the cell is more than just a bag of gadgets. The various components fit together to form a smoothly functioning whole, like an elaborate factory production line. The miracle of life is not that it is made of nanotools, but that these tiny diverse parts are integrated in a highly organized way."
Is the ultimate origin of the cell better explained as the product of advanced biomolecular engineering or is it better explained as the product of non-intelligent processes? Some scientists are logically inferring that life is carbon-based nanotechnology and are generating testable hypotheses from this perspective. One of them is Mike Gene. Here is an interesting observation from him:
"The specified complexity we find within the cell expresses itself in a dynamic three dimensional way and I would thus define it as machine-like complexity (MLC). With machine-like complexity, we are dealing with function that not only depends on arrangement (of parts), but also the conformation of those parts, their positioning, and timing. All of these are important such that you get coordinated movement of the parts as it is this coordinated movement that carries out the function....
Now as I see it, the inference to design from machine-like complexity (MLC) is a pretty darn reliable inference. I go through life inferring intelligence from MLC and don't live in a maze of confusion because of multiple mistakes in inferring intelligence from MLC, only to find the MLC arose from some non-intelligent mechanism. In the world I move through, intelligence is the default explanation for machine-like complexity, not merely because experience says so, but because MLC can be rationally viewed as the frozen trace of Mind. It's such a *natural*, free-flowing, and beautifully simple inference that I would need more than a possibility to attribute it to something other than intelligence. When I confront MLC, I don't naturally say, "Now *there's* evidence of a non-intelligent cause!" Perhaps if I had a history of being misled by this inference, I would take the mere possibility of MLC coming from non-intelligent mechanisms more seriously. Those who insist on attributing MLC to non-intelligence are free to do so a far as I am concerned. But if they expect me to make the same attribution, they will need more than a claim about how things might happen. They will need some good old-fashioned evidence to show that the particular example of MLC in question did indeed arise from a non-intelligent mechanism. I simply see no evidence that machine-like complexity-from-non-machine-like complexity is generated by non-teleological means, yet it is also quite clear that ID is a known cause for machine-like complexity."
Prisca
April 13th, 2002, 05:31 PM
http://www.taucon.com/stoneAxe1.jpg
http://www.finditoutdoors.com/storepics/gametracker_firstcut90_small.jpg
If we can determine that there is a dividing line between an arrowhead that might have been the product of natural processes and one that is obviously the product of ID, perhaps we can move on to biological systems. (The arrowhead, after all, is not a part of a functioning system until it is put into use by the arrow-maker himself.)
So, let’s look at a biological system. Lion mentioned the flagellum found on some bacteria:
http://www.arn.org/docs/mm/flag_labels2.jpg
Does the flagellum display MLC (machine-like complexity as described by Warren) or does it not? If so, does this MLC infer ID?
ThinkerThinker
April 15th, 2002, 02:56 PM
Originally posted by Warren
If a critic finds the current blind watchmaker inadequate to explain everything that's occurred in natural history, his only permissible move within science is to suggest a better blind watchmaker. That a competent blind watchmaker may not exist at all and that certain aspects of biotic reality may be better explained by a seeing watchmaker is not a logical possibility. Thus, most scientists don't investigate to determine IF life evolved, they only search for ways life DID evolve. Now, why should it be surprising to materialists that non-materialists remain skeptical of the current blind watchmaker hypothesis and feel that evidence for a seeing watchmaker may not be getting a fair hearing?
Both the scientist and the religious person have to base their initial assumption about the world on believes. The question is how far to we extend these believes. The scientist sets his or her marker as short as possible. In other words the scientists believes are as close to the available proves as possible so that he or she can say it is probable that we might eventually fill in the gabs and not have to believe anymore. This is a very uncomfortable position for the scientist and the stress that this creates drives the need for answers.
The religious person prefers not to exist in this stressful situation. He or she extends the belief as far as it needs to go to answer any question. The problem with this is that the need for answers is diminished because they presuppose they have the answer already. With such an outlook we would have had a different world today. I am not saying we would not have had scientific discovery but such discovery would have been driven by the unintentional discovery of contradictions.
TT
ThinkerThinker
April 15th, 2002, 03:14 PM
Originally posted by Becky
If we can determine that there is a dividing line between an arrowhead that might have been the product of natural processes and one that is obviously the product of ID, perhaps we can move on to biological systems.
I think when we attempt to find the line between what was designed by intelligence and what is natural we should not look at extreme examples but at those that fall on the border.
There first have to be enough knowledge of what we term natural. We term something as designed by intelligence if it deviates from this base knowledge in terms of form, function or structure.
Eg. We have a base knowledge of what geometric forms a set of objects can possible form in nature. If we see three stones set in a perfect triangle we are not sure if they were placed there naturally or by intelligent design because our base knowledge dictates it is possible for nature to form such a shape. When we find six stones placed in a perfect hexagon the probability shifts more toward it being placed there by an intelligence and when we find two hundred stones in a perfect circle it has such a high probability that it was placed there by intelligence that we feel sure it was by intelligence.
If we did not have a base knowledge that snowflakes were a natural occurrence we would have had to assume it was a produced by intelligence. In the same context, if we were to go to another planet and found something there which we assume was produced by an intelligence that assumption would be based on our knowledge of what is natural on earth and of what we have alreay discoverd on other planets in our solar system. It will not take into account natural processes of which we have no knowledge. Once we discover these hypothetical processes, we will then be in a posibion to revise our assumptions.
As our base knowledge increases the line between what is natural and what is produced by intelligence becomes more refined. That is why the question whether the human mind was produced by intelligence is still unclear. My BELIEF is that, as we discover more about the biological processes involved and what exactly the mind and intelligence is we will see that it IS a natural process but for now it is still a belief. The reason why I think it is a better belief to hold than believing it was produced by a higher intelligence is answered in my previous post.
TT
Prisca
April 15th, 2002, 05:03 PM
You said, “I think when we attempt to find the line between what was designed by intelligence and what is natural we should not look at extreme examples but at those that fall on the border.”
TT, that was the point (no pun intended) of the first picture I posted. Remember? The one that was posted over and over again? In fact, here it is again:
http://www.fastlane.net/~sterling/pointpics/2garys.JPG
Now the likelihood is that both of these are examples of ID. However, the one on the right seems to have a higher probability of being the product of ID than the one on the left, and both have a higher probability than the one posted by you. But there is no doubt that this…http://www.finditoutdoors.com/storepics/gametracker_firstcut90_small.jpg
is anything BUT the product of ID.
So, lets put arrowheads behind us and try to determine if this…
http://www.arn.org/docs/mm/flag_labels2.jpg
has the earmarks of ID or not.
ThinkerThinker
April 16th, 2002, 05:25 AM
Originally posted by Becky
So, lets put arrowheads behind us and try to determine if this…
http://www.arn.org/docs/mm/flag_labels2.jpg
has the earmarks of ID or not.
I'm not sure what the point is. According to my definition the image above represents an object with a extremely high probability of being designed by an intelligence. In fact, so high I would be willing to say it was definitly designed by intelligence.
So?
TT
Prisca
April 16th, 2002, 03:23 PM
You said, “According to my definition the image above represents an object with a extremely high probability of being designed by an intelligence. In fact, so high I would be willing to say it was definitly designed by intelligence.
So?”
So? You do realize that this is a bacterial flagella, right?
Prisca
April 16th, 2002, 03:29 PM
I found this animated version...
http://www.unlimitedglory.org/fdsmall.gif
Did you know that the Bacterial Flagellum requires over 50 different, separate* protein parts for operation?
Pretty amazing!
KurtPh
April 16th, 2002, 08:00 PM
Yep, the natural world and evoluton are pretty remarkable. ;)
Vann
April 16th, 2002, 09:46 PM
Becky,
Though your example is clever, it is more rhetorical than anything else. Whether or not anyone thinks that is designed by something intelligent is irrelevant in most every regard except to discover one's natural biases.
*Please note: I'm neither supporting or denying the validity of ID or evolution or anything else other than Becky's example. Any comment inferring otherwise is incorrect in its assumptions.
JGaltJr.
April 16th, 2002, 10:01 PM
I would say from Becky's example it'd be easy to assume intelligent design. Of course it's also be easy to look at the earth and assume it's flat.
Prisca
April 16th, 2002, 10:26 PM
You said, “Yep, the natural world and evolut[i]on are pretty remarkable.”
Kurt, you must have incredible faith to believe that biological structures, such as the one above, came about by chance. If that is where you choose to place your faith, then so be it. Please realize though, that those of us who don’t believe as you do, have valid reasons for believing what we do.
***********************************************
Prov. 26:10 The great God who formed everything Gives the fool his hire and the transgressor his wages.
JGaltJr.
April 16th, 2002, 10:32 PM
What kind of valid reasons? And there really is no need to stoop to the level of claiming that non-belief is a faith based system.
Prisca
April 16th, 2002, 11:06 PM
You said, “Though your example is clever, it is more rhetorical than anything else. Whether or not anyone thinks that is designed by something intelligent is irrelevant in most every regard except to discover one's natural biases.”
Why would you come to this conclusion? How could the study of the origins of biological structures be irrelevant? Seems to me there is a double standard when it comes to those who interested in ID. Are scientists not looking for signs of intelligence elsewhere in the universe? In fact, over $150 million (http://www.seti-inst.edu/general/seti-his.html) has been spent on just such a prospect.
Yet..,
"...An intelligible communication via radio signal from some distant galaxy would be widely hailed as evidence of an intelligent source. Why then doesn't the message sequence on the DNA molecule also constitute prima facie evidence for an intelligent source? After all, DNA information is not just analogous to a message sequence such as Morse code, it is such a message sequence."
(Charles B Thaxton, Walter L Bradley and Robert L Olsen: The Mystery of Life's Origin, Reassessing Current Theories (New York Philosophical Library 1984) pp 211-212)
Prisca
April 16th, 2002, 11:22 PM
You said, “I would say from Becky's example it'd be easy to assume intelligent design. Of course it's also be easy to look at the earth and assume it's flat.”
If you can explain the logic behind this kind of reasoning, then perhaps you deserve more credit than I am willing to give you at this point. For now, I can only assume that you have no understanding of the principles of science or logic.
Then you said, “And there really is no need to stoop to the level of claiming that non-belief is a faith based system.”
I was referring to Kurt’s faith in naturalistic processes and evolution. He said nothing about non-belief. Perhaps you need to re-read his comment.
JGaltJr.
April 16th, 2002, 11:29 PM
Becky you're starting to sound like your brother. Is the condescension really necessary? I specifically asked, "What kind of valid reasons" and you ignored this in favor of this "For now, I can only assume that you have no understanding of the principles of science or logic."
Care to answer my question or not?
ThinkerThinker
April 17th, 2002, 02:45 AM
Originally posted by Becky
So? You do realize that this is a bacterial flagella, right?
Yes, I do realise it is bacterial flagella. My point is best illustrated in this way.
for (i=1; typeof _root["p"+i] == "movieclip"; i++) {
if (_root["p"+i].hitTest(_root.runner1) == true) {
_root.score += (_root["p"+i].points)*3;
_root.graph.bar1._yscale += (_root["p"+i].points)*3;
_root["p"+i].points = 0;
_root["p"+i].play();
}
}
Among other things I am a programmer. When a non-programmer look at my code they are baffled by the incredible complexity of what they observe with no way of understanding what it means. When I look at it I see elegant simplicity of logic based on a few elementary rules. The complexity does no lie in the syntax, which is very simple, the complexity lies in the volume of parts and the way they relate and affect each other.
The key is lack understanding. If I have no understanding of the "syntax" of evolution then bacterial flagella will look incredibly complex to me and I will make the assumption that is was designed by intelligence. The more likely truth is that once I understand the "syntax" I will probably see the elegant simplicity of logic by which the bacterial flagella developed naturally.
There is still a vast amount of information we do not know yet. The danger of believing God did it all is that we would probably never find out what that information means and progress will be crippled and with that the benefits we might receive from it.
I much prefer the idea that, if there is a God, he did it all at the Big Bang and from there it is all natural.
TT
ThinkerThinker
April 17th, 2002, 03:13 AM
Yet..,
Quote:"...An intelligible communication via radio signal from some distant galaxy would be widely hailed as evidence of an intelligent source. Why then doesn't the message sequence on the DNA molecule also constitute prima facie evidence for an intelligent source? After all, DNA information is not just analogous to a message sequence such as Morse code, it is such a message sequence." (Charles B Thaxton, Walter L Bradley and Robert L Olsen: The Mystery of Life's Origin, Reassessing Current Theories (New York Philosophical Library 1984) pp 211-212)
Radio signals that contains a messages from which one can deduce intelligible communication is hardly the same as DNA information in the context of proving ID. Although structural principle the might have the same basis (i.e. coded) the proof of ID is not in the structural principle but in the change from what we know to be natural. Remember this quote:
ThinkerThinker wrote: There first have to be enough knowledge of what we term natural. We term something as designed by intelligence if it deviates from this base knowledge in terms of form, function or structure. (see one of my previous posts)
So, because natural radio signals does not, in our experience, carry messages containing the Pythagorean theory it has a very high probability that it is from an intelligence if it does.
To say DNA information is a message sequence is contextually wrong if used in the context of communication via radio signals. You should then say DNA information is an information sequence.
TT
Prisca
April 17th, 2002, 04:25 AM
First of all, you said, “I would say from Becky's example it'd be easy to assume intelligent design. Of course it's also be easy to look at the earth and assume it's flat.”
You expect me to ignore this illogical attack? You are trying to equate my reasoning that the flagellum displays MLC with the belief in a flat earth. Instead, why not give your own valid reasons for why you think the flagellum is not a product of ID? You are probably a smart guy, but using ad hominem attacks to try and discredit me is not the way to show it.
You asked, “Care to answer my question or not?”
If you can agree to have a logical discussion, then maybe it would be worth my time. For now, I think I’ll reserve my statements for TT who seems to have a better handle on the information at hand. Thanks anyway.;)
Prisca
April 17th, 2002, 05:15 AM
You said, “Yes, I do realise it is bacterial flagella. My point is best illustrated in this way.”
I thought you did, but your statement surprised me.
Now concerning the code you posted, you said…“When I look at it I see elegant simplicity of logic based on a few elementary rules. The complexity does no[t] lie in the syntax, which is very simple, the complexity lies in the volume of parts and the way they relate and affect each other.”
Exactly! The way the parts relate to and affect each other is vital. Now I am not a programmer, so I may be off base here, but would your code “work” or make sense if it were changed? For example, does this still make sense?
for (i1; typeof _root["p"+i] "movieclip"; i++) {
if (_root["p"+i].hitTest(_root.runner1) true) {
_root.score (_root["p"+i].points)*3;
_root.graph.bar1._yscale (_root["p"+i].points)*3;
_root["p"+i].points 0;
_root["p"+i].play();
}
}
How would the changes I made affect the outcome of the code? Would it still function? (For example, when you take the verb out of a sentence, you no longer have a sentence-you only have a fragment) I did a tiny bit of programming back when I had a Commodore 64, lol, and one little mistake in the code and my program did not function correctly. As far as genetics are concerned, a small change or mutation can have catastrophic effects on the organism. In the case of the flagellum, if we take away the paddle, the rotor, or the motor, it no longer functions as a swimming mechanism. How then, did each of these “highly tailored” parts happen to come together?
You said, “There is still a vast amount of information we do not know yet. The danger of believing God did it all is that we would probably never find out what that information means and progress will be crippled and with that the benefits we might receive from it.
Believing that God did something does not cause the scientist to throw up his hands and give up! History shows us that it is quite the contrary. ID theory does not cripple anything. It is merely an attempt to understand the complexity we see before us. You said, “I much prefer the idea that, if there is a God, he did it all at the Big Bang and from there it is all natural.”
Why would you prefer such an idea?
Prisca
April 17th, 2002, 05:55 AM
You said, “To say DNA information is a message sequence is contextually wrong if used in the context of communication via radio signals. You should then say DNA information is an information sequence.”
Message, signal, code, information sequence… they all inform or instruct in some way, correct? Sounds like semantics to me.
“The genetic code is the language used by living cells to convert information found in DNA into information needed to make proteins. A protein's structure, and therefore function, is determined by the sequence of amino acid subunits. The amino acid sequence of a protein is determined by the sequence of the gene encoding that protein. The "words" of the genetic code are called codons. Each codon consists of three adjacent bases in an mRNA molecule. Using combinations of A, U, C and G, there can be sixty four different three-base codons. There are only twenty amino acids that need to be coded for by these sixty four codons. This excess of codons is known as the redundancy of the genetic code. By allowing more than one codon to specify each amino acid, mutations can occur in the sequence of a gene without affecting the resulting protein.”
Just for fun, decode the following:
TTGAGAACAGCAATGGCAACGACAATGGATACAGTAGTAACCAGAACATG G
at http://www.dna2z.com/DNA-o-gram/decode.html
Make sure you enter it carefully - copy and paste is the best way.
JGaltJr.
April 17th, 2002, 06:46 AM
Originally posted by Becky
Quote:
First of all, you said, “I would say from Becky's example it'd be easy to assume intelligent design. Of course it's also be easy to look at the earth and assume it's flat.”
You expect me to ignore this illogical attack?
It's neither illogical nor an attack. It's in fact a very appropriate analogy that demonstrates that what looks obvious to the uninformed eye can be something quite different upon further investigation